Paper disk DNA preparation

After watching too much CSI I saw that genomic DNA was surprisingly stable at room temperature and could be isolated from an array of juices using cotton buds etc. It's kind of like making pressed flowers or a herbarium.

As there is already an excellent instuctable for a PCR machine (https://www.instructables.com/id/Coffee-Cup-PCR-Thermocycler-costing-under-350/ ), a method for rapid DNA template isolation may be of use.

SAFETY - Most people or animal juices have the potential for the transmission of pathogens so please take appropriate precautions.

Never lick the spoon when you are doing (non food based) Science!

I have used this method thousands of times with varrious plant materials. For Arabidopsis thaliana and Medicago truncatula the filter paper worked well, for more crunchy leaves from plants such as Ricinus communis I could get a green juice out but not much luck with PCR products, it could be the more robust leaf architecture prevented genomic DNA leaking out as well or it could have been inhibitory factors.

Have fun.

Materials

-Non absorbent disposable backing
I used parafilm (like a thick clingfilm) but clingfilm (e.g. saran wrap) could be used.

-Absorbent paper
I used Whatman filter paper. Tissue paper is probably too thin but a thin absorbent craft card may work.

-Pounding implement
I used a plastic container, you need to crush the leaf so anything from a hammer to a plastic cola bottle could be used.

-Hole punch
I had access to medical biopsy punches and I could get a good few uses before it got too blunt. A standard ring-binder hole punch will give you disks but they will be big and soak up a lot of PCR mix. Leather punches for belt holes work a treat.

Step 1: PCR Basics

An excellent introduction to PCR can be found on Wikipedia here .

Briefly PCR (polymrease chain reaction) is a method by which a small number of copies of a specific sequence can be amplified many thousands of times. This would be useful to generate enough DNA for sequencing or for checking the success of a cloning step.

Step 2: Method

Method

Place parafilm onto a clean surface and a filter paper onto the parafilm. Snip off a piece of tissue and place onto the filter paper (pic 1).
Place a second sheet of parafilm over the tissue and apply pressure (pic 2).
Remove the film and the plant material and you should get a nice ‘juicy’ impression of the crushed tissue. Leave this to dry at room temperature, it often takes an hour or so for larger leaves (pic 3).
Once dry the filter can be hole punched and the disks dropped straight into a PCR mix of 20ul (pic 4&5). Be aware the paper will soak some of the PCR so small volume reactions (<20 μl) may have issues depending on your disk size. The filter papers will be ok to store for several months, I have some which are >1 year (in a 4 'C) fridge and still gave the expected product. For these pictures i used the leather punch and it worked well at cutting the paper disk and gave an easy means to eject the disk from the punch.

Step 3: PCR Amplify

Now you have template DNA!
With appropriate primers you can amplify your sequence of choice. If you've managed to get hold of some Arabidopsis thaliana then the following should work for amplifying ACT2 (At3g18780 http://www.arabidopsis.org/servlets/TairObject?accession=locus:2093954 ) which will be a nice positive control, they were designed by my friend John Hamilton of Durham University.

Forward
5' GGATCGGTGGTTCCATTCTTGC

Reverse
5' AGAGTTTGTCACACACAAGTGCA

They work well with an annealing temp of 56-58 C. They span an intron so genomic will give 342bp product but if you use them for rt-PCR then cDNA will give 256bp.

The picture is an agarose gel of a PCR, The DNA is added to the wells and an electric current moves it through the gel, small bit can wiggle through faster so move further. On the left is a molecular weight marker made from digested phage DNA, the bands are known sizes so can be used to judge the size of our PCR products. Ethidium bromide was added to the gel so the DNA can be visualised with UV.